Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
hsa_circ_0001212 | |||
Gene | GUSBP11 | Organism | Human |
Genome Locus | chr22:24056373-24057381:- | Build | hg19 |
Disease | Cervical Carcinoma | ICD-10 | Malignant neoplasm of cervix uteri (C53) |
DBLink | Link to database | PMID | 28080204 |
Experimental Method | |||
Sample Type | HeLa Cell lines | Comparison | HeLa cells transfected with pcDNA3.0 or pCircPABPN1 (2 μg) or with control siRNAs |
Method for Estimation | Quantitative PCR and Microarrays | PCR Details | |
Primers (Experimented) | Forward GTGAAGCGAGACAGTGGTGA ReverseACCACAACCAGCTGACAAAA | Statistics | Fold Change : Upregulated pvalue : p<0.05 |
Citation | |||
Abdelmohsen, K, Panda, AC, Munk, R, Grammatikakis, I, Dudekula, DB, De, S, Kim, J, Noh, JH, Kim, KM, Martindale, JL, Gorospe, M (2017). Identification of HuR target circular RNAs uncovers suppression of PABPN1 translation by CircPABPN1. RNA Biol, 14, 3:361-369. |